Review



110099141c molecular probes tm dextran invitrogen cat  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Thermo Fisher 110099141c molecular probes tm dextran invitrogen cat
    110099141c Molecular Probes Tm Dextran Invitrogen Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41824452-251-206-207
    Average 99 stars, based on 1 article reviews
    110099141c molecular probes tm dextran invitrogen cat - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786; RRID:AB_258631 Anti-mouse integrin a3/CD49c antibody Novus Biologicals Cat# NBP1-19724; RRID:AB_1642429 Anti-human integrin a3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056; RRID:AB_94522 anti-proSPC antibody Millipore Cat# AB3786: RRID:AB_91588 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1; RRID:AB_2573460 anti-CCSP antibody Millipore-Merck Cat# 07-623; RRID:AB_310759 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142; RRID:AB_394657 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225; RRID:AB_2563983 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80; RRID:AB_891456 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-2231-82; RRID:AB_2573428 anti-CD31 FITC BD Pharmigen Cat# 553372; RRID:AB_394818 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410; RRID:AB_2687527 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008; RRID:AB_2337937 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008; RRID:AB_2337720 Anti-monkey IgG KPL/Sera Care Cat# 074-11-021; 5220-0333 Anti-monkey IgA KPL/Sera Care Cat# 074-11-011; 5220-0332 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5a electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Chemicals, Peptides, and Recombinant Proteins a3b1 R&D Systems Cat# 2840-A3-050 a6b1 R&D Systems Cat# 7809-A6-050 a6b4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 (Continued on next page) Med 2, 321–342.e1–e8, March 12, 2021 e1 . .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit QIAGEN Cat# 12145 Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA.

    MTT Assay:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Liposomes:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Control:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    shRNA:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    cDNA Synthesis:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    SYBR Green Assay:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    ATP Assay:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Purification:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Microarray:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Quantitative RT-PCR:

    Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers. ..

    Blocking Assay:

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786; RRID:AB_258631 Anti-mouse integrin a3/CD49c antibody Novus Biologicals Cat# NBP1-19724; RRID:AB_1642429 Anti-human integrin a3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056; RRID:AB_94522 anti-proSPC antibody Millipore Cat# AB3786: RRID:AB_91588 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1; RRID:AB_2573460 anti-CCSP antibody Millipore-Merck Cat# 07-623; RRID:AB_310759 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142; RRID:AB_394657 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225; RRID:AB_2563983 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80; RRID:AB_891456 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-2231-82; RRID:AB_2573428 anti-CD31 FITC BD Pharmigen Cat# 553372; RRID:AB_394818 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410; RRID:AB_2687527 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008; RRID:AB_2337937 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008; RRID:AB_2337720 Anti-monkey IgG KPL/Sera Care Cat# 074-11-021; 5220-0333 Anti-monkey IgA KPL/Sera Care Cat# 074-11-011; 5220-0332 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5a electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Chemicals, Peptides, and Recombinant Proteins a3b1 R&D Systems Cat# 2840-A3-050 a6b1 R&D Systems Cat# 7809-A6-050 a6b4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 (Continued on next page) Med 2, 321–342.e1–e8, March 12, 2021 e1 . .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit QIAGEN Cat# 12145 Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA.

    Virus:

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786; RRID:AB_258631 Anti-mouse integrin a3/CD49c antibody Novus Biologicals Cat# NBP1-19724; RRID:AB_1642429 Anti-human integrin a3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056; RRID:AB_94522 anti-proSPC antibody Millipore Cat# AB3786: RRID:AB_91588 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1; RRID:AB_2573460 anti-CCSP antibody Millipore-Merck Cat# 07-623; RRID:AB_310759 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142; RRID:AB_394657 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225; RRID:AB_2563983 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80; RRID:AB_891456 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-2231-82; RRID:AB_2573428 anti-CD31 FITC BD Pharmigen Cat# 553372; RRID:AB_394818 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410; RRID:AB_2687527 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008; RRID:AB_2337937 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008; RRID:AB_2337720 Anti-monkey IgG KPL/Sera Care Cat# 074-11-021; 5220-0333 Anti-monkey IgA KPL/Sera Care Cat# 074-11-011; 5220-0332 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5a electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Chemicals, Peptides, and Recombinant Proteins a3b1 R&D Systems Cat# 2840-A3-050 a6b1 R&D Systems Cat# 7809-A6-050 a6b4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 (Continued on next page) Med 2, 321–342.e1–e8, March 12, 2021 e1 . .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit QIAGEN Cat# 12145 Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA.

    Plasmid Preparation:

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786; RRID:AB_258631 Anti-mouse integrin a3/CD49c antibody Novus Biologicals Cat# NBP1-19724; RRID:AB_1642429 Anti-human integrin a3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056; RRID:AB_94522 anti-proSPC antibody Millipore Cat# AB3786: RRID:AB_91588 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1; RRID:AB_2573460 anti-CCSP antibody Millipore-Merck Cat# 07-623; RRID:AB_310759 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142; RRID:AB_394657 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225; RRID:AB_2563983 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80; RRID:AB_891456 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-2231-82; RRID:AB_2573428 anti-CD31 FITC BD Pharmigen Cat# 553372; RRID:AB_394818 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410; RRID:AB_2687527 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008; RRID:AB_2337937 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008; RRID:AB_2337720 Anti-monkey IgG KPL/Sera Care Cat# 074-11-021; 5220-0333 Anti-monkey IgA KPL/Sera Care Cat# 074-11-011; 5220-0332 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5a electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Chemicals, Peptides, and Recombinant Proteins a3b1 R&D Systems Cat# 2840-A3-050 a6b1 R&D Systems Cat# 7809-A6-050 a6b4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 (Continued on next page) Med 2, 321–342.e1–e8, March 12, 2021 e1 . .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit QIAGEN Cat# 12145 Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA.

    Bicinchoninic Acid Protein Assay:

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.

    Mouse Assay:

    Article Title: Targeted Phage Display-based Pulmonary Vaccination in Mice and Non-human Primates
    Article Snippet: The analyses were performed in GraphPad Prism 8 and MATLAB R2015b. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-fd bacteriophage antibody Sigma-Aldrich Cat# B7786 Anti-mouse integrin α3/CD49c antibody Novus Biologicals Cat# NBP1-19724 Anti-human integrin α3 (ASC-1) blocking antibody Millipore Sigma Cat# MAB2056Z anti-proSPC antibody Millipore Cat# AB3786 anti-podoplanin antibody Thermo-Invitrogen Cat# eBio8.1.1 anti-CCSP antibody Millipore-Merck Cat# 07-623 anti-mouse CD16/CD32 antibody BD Pharmigen Cat# 553142 rat anti-mouse EPCAM brilliant violet 421 BioLegend Cat# 118225 anti-mouse CD45 Alexa fluor 700 eBioscience Cat# 56-0451-80 anti-mouse podoplanin monoclonal antibody PE-Cyanine 7 eBioscience Cat# 25-5382-80 anti-CD31 FITC BD Pharmigen Cat# 553372 anti-mouse F4/80 PE-conjugated BD Pharmigen Cat# 565410 Anti-rabbit Horseradish peroxidase (HRP)-conjugated secondary antibody Jackson ImmunoResearch Cat# 111-035-008 Cy3-conjugated goat anti-human secondary antibody Jackson ImmunoResearch Cat# 109-165-008 Anti-monkey IgG KPL Cat# 074-11-021 Anti-monkey IgA KPL Cat# 074-11-011 Bacterial and Virus Strains fUSE5 bacteriophage Laboratory of Dr. George L. Smith N/A K91 E. coli Laboratory of Dr. George L. Smith N/A DH5α electrocompetent Invitrogen Cat# 11319019 pGEX4T-1 plasmid Amersham/ Addgene Cat# 27458001 Biological Samples Chemicals, Peptides, and Recombinant Proteins α3β1 R&D Systems Cat# 2840-A3-050 α6β1 R&D Systems Cat# 7809-A6-050 α6β4 R&D Systems Cat# 5497-A6-050 NRP-1 R&D Systems Cat# 3870-N1-025 SDC-1 R&D Systems Cat# 2780-SD-050 CAKSMGDIVC peptide Biomatik Cat# 293308 Lot# P120420-SL293308 CGRRAGGSC peptide PolyPeptide N/A Triton X-100 Sigma-Aldrich Cat# 9002-93-1 Triton X-114 Sigma-Aldrich Cat# 9036-19-5 Dextran Invitrogen Cat# D1822 Evans Blue Sigma-Aldrich Cat# 314-13-6 LPS - Klebsiella pneumoniae Sigma-Aldrich Cat# L4268 Trypan Blue ThermoFisher Scientific Cat# 15250061 Protein G agarose resin Roche Cat# 11-243-233-001 Jacalin ThermoScientific Cat# 20395 Histochoice Sigma-Aldrich Cat# H2904 Dako Target Retrieval Solution Agilent Dako Cat# S169984-2 T4 DNA ligase Roche Cat# 10799009001 Critical Commercial Assays BCA Protein Assay ThermoFisher Scientific Cat# 23227 QIAGEN Plasmid Midi Kit Qiagen Cat# 12145 Deposited Data Experimental Models: Cell Lines A549 ATCC Cat# CCL-185 Experimental Models: Organisms/Strains Mice/ BALB/cJ The Jackson Laboratory Stock # 000651 Rhesus monkeys Michale E. Keeling Center for Comparative Medicine and Research – MDACC, Bastrop, TX, USA. .. N/A Oligonucleotides qPCR fUSE5 forward: 5′-TGAGGTGGTATCGGCAATGA-3′ Sigma-Aldrich N/A qPCR fUSE5 reverse: 5′-GGATGCTGTATTTAGGCCGTTT-3′ Sigma-Aldrich N/A Sequencing fUSE5 forward 5’-AGCAAGCTGATAAACCGATACAATT-3’ Sigma-Aldrich N/A Sequencing fUSE5 reverse 5’-CCCTCATAGTTAGCGTAACGATCT-3’ Sigma-Aldrich N/A CAKSMGDIVC forward 5’-GGGCTTGTGCGAAAAGCATGGGCGATATCGTGTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CAKSMGDIVC reverse 5’- CGGCCCCACACACGATATCGCCCATGCTTTTCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A CGRKQVESSC forward 5’-GGGCTTGTGGCCGCAAACAGGTGGAAAGCAGCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CGRKQVESSC reverse 5’- CGGCCCCACAGCTGCTTTCCACCTGTTTGCGGCCACAAGCCCCGT-3’ Sigma-Aldrich N/A CRGKSAEGTC forward 5’ GGGCTTGTCGCGGCAAAAGCGCGGAAGGCACCTGTGGGGCCGCTG-3’ Sigma-Aldrich N/A CRGKSAEGTC reverse CGGCCCCACAGGTGCCTTCCGCGCTTTTGCCGCGACAAGCCCCGT-3’ Sigma-Aldrich N/A CAINSLSRKC forward 5’ GGGCTTGTGCGATCAACAGCCTGAGCCGCAAATGTGGGGCCGCT Sigma-Aldrich N/A CAINSLSRKC reverse 5’ CGGCCCCACATTTGCGGCTCAGGCTGTTGATCGCACAAGCCCCGT-3’ Sigma-Aldrich N/A Recombinant DNA shRNA lentivirus ITGA3 Sigma-Aldrich Cat#: 002204.2-1161s21c1; 002204.1-2356s1c1; 002204.1-2887s1c1. shRNA lentivirus ITGB1 Sigma-Aldrich Cat#: TRCN0000275133; TRCN0000275134; TRCN0000275135.



    Similar Products

    mouse miltenyi biotec 130 052 301 dako fluorescent mounting medium dako s3023 dextran cascade blue 10 000 mw invitrogen d1976 dispase thermo fisher  (Miltenyi Biotec)
    97
    Miltenyi Biotec mouse miltenyi biotec 130 052 301 dako fluorescent mounting medium dako s3023 dextran cascade blue 10 000 mw invitrogen d1976 dispase thermo fisher
    Mouse Miltenyi Biotec 130 052 301 Dako Fluorescent Mounting Medium Dako S3023 Dextran Cascade Blue 10 000 Mw Invitrogen D1976 Dispase Thermo Fisher, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/CD45+MicroBeads%2C+mouse/pm42102979-696-59-60
    Average 97 stars, based on 1 article reviews
    mouse miltenyi biotec 130 052 301 dako fluorescent mounting medium dako s3023 dextran cascade blue 10 000 mw invitrogen d1976 dispase thermo fisher - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    110099141c molecular probes tm dextran invitrogen cat  (Thermo Fisher)
    99
    Thermo Fisher 110099141c molecular probes tm dextran invitrogen cat
    110099141c Molecular Probes Tm Dextran Invitrogen Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41824452-251-206-207
    Average 99 stars, based on 1 article reviews
    110099141c molecular probes tm dextran invitrogen cat - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    nc9660079 fitc dextran invitrogen  (Thermo Fisher)
    99
    Thermo Fisher nc9660079 fitc dextran invitrogen
    Nc9660079 Fitc Dextran Invitrogen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41385366-326-22-24
    Average 99 stars, based on 1 article reviews
    nc9660079 fitc dextran invitrogen - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    j60104 ak alexa fluor 594 dextran invitrogen  (Thermo Fisher)
    99
    Thermo Fisher j60104 ak alexa fluor 594 dextran invitrogen
    J60104 Ak Alexa Fluor 594 Dextran Invitrogen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41289991-246-78-82
    Average 99 stars, based on 1 article reviews
    j60104 ak alexa fluor 594 dextran invitrogen - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    31430 invitrogen gibco life science technology inc  (Thermo Fisher)
    97
    Thermo Fisher 31430 invitrogen gibco life science technology inc
    31430 Invitrogen Gibco Life Science Technology Inc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN+SULFATE+SODIUM+SALT+MW/pmc12731203-80-16-17
    Average 97 stars, based on 1 article reviews
    31430 invitrogen gibco life science technology inc - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    mass 70 kd tmr dextran invitrogen uptake assay  (Thermo Fisher)
    99
    Thermo Fisher mass 70 kd tmr dextran invitrogen uptake assay
    Mass 70 Kd Tmr Dextran Invitrogen Uptake Assay, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/us12458630-813-5-9
    Average 99 stars, based on 1 article reviews
    mass 70 kd tmr dextran invitrogen uptake assay - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    3000 mw fluorescent dextran invitrogen  (Thermo Fisher)
    99
    Thermo Fisher 3000 mw fluorescent dextran invitrogen
    3000 Mw Fluorescent Dextran Invitrogen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41043393-1017-63-67
    Average 99 stars, based on 1 article reviews
    3000 mw fluorescent dextran invitrogen - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    yeast trna invitrogen cat  (Thermo Fisher)
    99
    Thermo Fisher yeast trna invitrogen cat
    Yeast Trna Invitrogen Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm41038164-261-75-77
    Average 99 stars, based on 1 article reviews
    yeast trna invitrogen cat - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    alexa fluortm 555 dextran invitrogen  (Thermo Fisher)
    99
    Thermo Fisher alexa fluortm 555 dextran invitrogen
    Alexa Fluortm 555 Dextran Invitrogen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dextran+invitrogen/DEXTRAN/pm40551010-229-97-101
    Average 99 stars, based on 1 article reviews
    alexa fluortm 555 dextran invitrogen - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results